Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 117858925 117873955 enh42219

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 117872696 rs141013456 GGTTGCTGGGGGCCAGTGGGAAAGCT G 11253656
chr9 117872700 rs189206585 G T 11253657
chr9 117872702 rs557013209 T A 11253658
chr9 117872704 rs574187410 G T 11253659
chr9 117872707 rs536843212 G C 11253660

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results