Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 3655305 3670583 enh36304

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 3663939 rs533947784 T TGGCGCGTGGAGAGAGGATGAG 7359192

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results