Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 4488772 rs189094510 A C 7365374
chr4 4488781 rs555230434 TTCAGAGGCTTTTGGTTCATGGAGC T 7365375

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results