Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 7132893 7143575 enh36323

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 7138967 rs545018282 C T 7383673
chr4 7138967 rs567273110 CCTTTCCCCCAGGCTGGTATGGAGAT C 7383674

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results