Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 8109705 8122075 enh65814

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 8119358 rs530451268 T TCCACCCACTTTTCCTCTGGCCC 7394099

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results