EnhancerDB
  1. Home
  2. TFBS
  3. GATA2[chr4:84127929-84127934]
Chromosome characteristics of GATA2[chr4:84127929-84127934]
Back to top
Enhancers possibly regulated by GATA2[chr4:84127929-84127934]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 84126925 84145939 enh8045
Skin (Keratinocyte) Cervix (HeLa-S3) Prostate (RWPE1) Blood (T-cell) Esophagus Lung (PC-9) Blood (OCI-LY7) Blood (GM12878) Placenta Thyroid Peripheral Blood (MM.1S) Blood (Karpas-422) Muscle (Myoblast) Pancreas Spleen Muscle (Myotube) Thymus Stomach
SNP sites on GATA2[chr4:84127929-84127934]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 84127929 rs564158786 A ACTACACCTACTACACCTAC 7653088
chr4 84127932 rs536237404 T C 7653089
chr4 84127933 rs554712589 C A 7653090
Genes possibly regulated by GATA2[chr4:84127929-84127934]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by GATA2[chr4:84127929-84127934]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results