Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 370815 rs138748070 C CTACAACCTCCGCCTCCTGGG,CTGGG 4245080
chr16 370815 rs58703541 C CTACAACCTCCGCCTCCTGGG 4245081

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results