EnhancerDB
  1. Home
  2. TFBS
  3. HNF4G[chr16:388961-388976]
Chromosome characteristics of HNF4G[chr16:388961-388976]
Back to top
Enhancers possibly regulated by HNF4G[chr16:388961-388976]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 364825 394775 enh16487
Bone Marrow (K562) Astrocyte Colon (HCT116) Pancreas Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myotube) Liver (HepG2) Muscle (A673) Heart
SNP sites on HNF4G[chr16:388961-388976]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 388961 rs181580929 G A 4245457
chr16 388967 rs112874412 ACAGAGTCCAGCAGAGCACCAG A 4245458
chr16 388967 rs71139774 ACAGAGTCCAGCAGAGCACCAG A 4245459
Genes possibly regulated by HNF4G[chr16:388961-388976]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by HNF4G[chr16:388961-388976]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results