Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 388967 rs112874412 ACAGAGTCCAGCAGAGCACCAG A 4245458
chr16 388967 rs71139774 ACAGAGTCCAGCAGAGCACCAG A 4245459

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results