Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 88596925 88603721 enh71278

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 88600200 rs138754888 ATTACTTAATTACTTGTCCATCTTTCTTCTCTT A 7672780
chr4 88600200 rs371628989 ATTACTTAATTACTTGTCCATCTTTCTTCTCTT A 7672781
chr4 88600200 rs564123798 A G 7672782
chr4 88600200 rs752896848 ATTACTTAATTACTTGTCCATCTTTCTTCTCTT A 7672783

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results