EnhancerDB
  1. Home
  2. TFBS
  3. PHOX2A[chr4:88600200-88600211]
Chromosome characteristics of PHOX2A[chr4:88600200-88600211]
Back to top
Enhancers possibly regulated by PHOX2A[chr4:88600200-88600211]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 88596925 88603721 enh71278
Neural Stem Cells (H9) Uterus Ovary Embryonic Stem Cell Line (H1-hESC)
SNP sites on PHOX2A[chr4:88600200-88600211]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 88600200 rs138754888 ATTACTTAATTACTTGTCCATCTTTCTTCTCTT A 7672780
chr4 88600200 rs371628989 ATTACTTAATTACTTGTCCATCTTTCTTCTCTT A 7672781
chr4 88600200 rs564123798 A G 7672782
chr4 88600200 rs752896848 ATTACTTAATTACTTGTCCATCTTTCTTCTCTT A 7672783
Genes possibly regulated by PHOX2A[chr4:88600200-88600211]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PHOX2A[chr4:88600200-88600211]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results