Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 88820625 88840034 enh21671

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 88831530 rs112115959 C T 7673944
chr4 88831533 rs144683461 G GCATTCCAGGGCTGGTGACCC 7673945

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results