Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 90410925 90421295 enh71285

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 90414528 rs569037338 C CTTATTCTTAAACTAAGAATGCTT 7682226

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results