EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2A[chr16:1243188-1243203]
Chromosome characteristics of TFAP2A[chr16:1243188-1243203]
Back to top
Enhancers possibly regulated by TFAP2A[chr16:1243188-1243203]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 1228905 1244901 enh31664
Liver (HepG2) Prostate (RWPE1) Ovary Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Colon (HCT116) Thyroid Pancreas Uterus Epithelial (MCF-7)
SNP sites on TFAP2A[chr16:1243188-1243203]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 1243194 rs9926274 T C 4254620
chr16 1243196 rs118132803 G A 4254621
chr16 1243199 rs533764744 AAATGATGGCCCTCAGAGATGCACAAAG A 4254622
Genes possibly regulated by TFAP2A[chr16:1243188-1243203]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2A[chr16:1243188-1243203]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results