EnhancerDB
  1. Home
  2. TFBS
  3. RREB1[chr16:3209781-3209801]
Chromosome characteristics of RREB1[chr16:3209781-3209801]
Back to top
Enhancers possibly regulated by RREB1[chr16:3209781-3209801]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 3205284 3226809 enh62538
Bone Marrow (K562) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Esophagus Colon (HCT116) Pancreas Pancreas (Panc1) Uterus Blood (T-cell) Stomach
SNP sites on RREB1[chr16:3209781-3209801]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 3209782 rs149067848 AGTGTGTGTGTGTGTGTGTGT A 4267640
chr16 3209782 rs556529207 AGTGTGTGTGTGTGTGTGTGT A 4267641
chr16 3209782 rs71158145 AGTGTGTGTGTGTGTGTGTGT A 4267642
Genes possibly regulated by RREB1[chr16:3209781-3209801]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RREB1[chr16:3209781-3209801]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results