Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 3205284 3226809 enh62538

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 3214643 rs566736384 C CCCTGAGAGGTCCCGGCCTGGAG 4267761

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results