Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 119784282 119793223 enh71401

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 119785253 rs140496955 AACTTTCCTCTTAGTACTGCTTTTGCTG A 7773903

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results