Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 4046925 4053274 enh16509

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 4049478 rs546803650 A AAGGAGGACCCAGGAATAATCCTGGCACC 4272501
chr16 4049478 rs561113283 A C 4272502

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results