EnhancerDB
  1. Home
  2. TFBS
  3. USF2[chr4:123587595-123587606]
Chromosome characteristics of USF2[chr4:123587595-123587606]
Back to top
Enhancers possibly regulated by USF2[chr4:123587595-123587606]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 123577965 123592166 enh36992
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Colon (HCT116) Peripheral Blood (MM.1S) Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Uterus
SNP sites on USF2[chr4:123587595-123587606]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 123587595 rs532763802 GGGTCACCTGGTTCTTTTTA G 7786577
chr4 123587596 rs368397464 G C 7786578
chr4 123587603 rs185848222 T G 7786579
Genes possibly regulated by USF2[chr4:123587595-123587606]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by USF2[chr4:123587595-123587606]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results