Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 14651685 14665375 enh52227

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 14664935 rs551834210 C T 4344853
chr16 14664939 rs375100757 TTCCCAATAAAAGTCTAAAAC T 4344854
chr16 14664939 rs567196100 TTCCCAATAAAAGTCTAAAAC T 4344855

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results