Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 17837145 17844795 enh69065

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 17841633 rs146439114 C T 4357751
chr16 17841638 rs536622596 A AAATTGAGTCAAGCTACAGCACAACC 4357752

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results