EnhancerDB
  1. Home
  2. TFBS
  3. FOXB1[chr6:25015977-25015988]
Chromosome characteristics of FOXB1[chr6:25015977-25015988]
Back to top
Enhancers possibly regulated by FOXB1[chr6:25015977-25015988]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 24994525 25030795 enh9006
Brain (SK-N-MC) Astrocyte Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Thymus Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Spleen Muscle (Myotube) Prostate (RWPE1) Heart
SNP sites on FOXB1[chr6:25015977-25015988]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 25015983 rs575743438 T C 8918243
chr6 25015985 rs537084961 C CATATTGTAGAGGGAGGTGGAGAAAATACTCAT 8918244
chr6 25015985 rs544869020 C T 8918245
Genes possibly regulated by FOXB1[chr6:25015977-25015988]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXB1[chr6:25015977-25015988]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results