EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr6:31039284-31039305]
Chromosome characteristics of ZNF263[chr6:31039284-31039305]
Back to top
Enhancers possibly regulated by ZNF263[chr6:31039284-31039305]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 31022954 31045508 enh38944
Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Ovary Bone (Osteoblast) Muscle (A673) Colon (HCT116) Thyroid Uterus Lung (PC-9) Breast Spleen Muscle (Myotube) Neural Stem Cells (H9) Stomach
SNP sites on ZNF263[chr6:31039284-31039305]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 31039292 rs372161328 G GAGGAGGCGGGCGGAGGGCAGATCGGCCT 8952164
chr6 31039292 rs544401626 G GAGGAGGCGGGCGGAGGGCAGATCGGCCT 8952165
chr6 31039292 rs561892661 G T 8952166
Genes possibly regulated by ZNF263[chr6:31039284-31039305]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr6:31039284-31039305]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results