Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 31039292 rs372161328 G GAGGAGGCGGGCGGAGGGCAGATCGGCCT 8952164
chr6 31039292 rs544401626 G GAGGAGGCGGGCGGAGGGCAGATCGGCCT 8952165
chr6 31039292 rs561892661 G T 8952166

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results