Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 111849525 111864816 enh49144

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 111858739 rs199701023 A AAAACTTCTTTAAGTAAATT,ATT 9262406
chr6 111858739 rs9398273 A T 9262407

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results