EnhancerDB
  1. Home
  2. TFBS
  3. ELF4[chr14:62026217-62026229]
Chromosome characteristics of ELF4[chr14:62026217-62026229]
Back to top
Enhancers possibly regulated by ELF4[chr14:62026217-62026229]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 62012585 62031906 enh3258
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Adrenal Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Thyroid Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Spleen Liver (HepG2) Prostate (RWPE1) Heart
chr14 62026213 62026731 vista18033
VISTA
SNP sites on ELF4[chr14:62026217-62026229]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 62026227 rs149575909 GAACCTTAGTTTCCTTGTCTGTAAAATTAAGA G 3591843
chr14 62026227 rs370926842 GAACCTTAGTTTCCTTGTCTGTAAAATTAAGA G 3591844
chr14 62026227 rs377161409 GAACCTTAGTTTCCTTGTCTGTAAAATTAAGA G 3591845
Genes possibly regulated by ELF4[chr14:62026217-62026229]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ELF4[chr14:62026217-62026229]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results