EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:44230171-44230823]
Chromosome characteristics of ZNF274[chr1:44230171-44230823]
Back to top
Enhancers possibly regulated by ZNF274[chr1:44230171-44230823]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 44221165 44237481 enh300
Skin (Keratinocyte) Liver (HepG2) Brain (SK-N-MC) Prostate (RWPE1) Lung (PC-9) Esophagus Blood (GM12878) Muscle (A673) Thyroid Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas (Panc1) Neural Stem Cells (H9) Epithelial (MCF-7)
chr1 44230271 44230532 vista1417
VISTA
SNP sites on ZNF274[chr1:44230171-44230823]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 44230258 rs10890279 G A 274837
chr1 44230287 rs181419050 G A 274838
chr1 44230387 rs72886813 C G,T 274839
chr1 44230416 rs74070676 G C 274840
chr1 44230572 rs114315772 C A,T 274841
chr1 44230599 rs558543448 A G 274842
chr1 44230661 rs556471336 TACTTGTTATTTTTAACTTTAAGAATAAAA T 274843
chr1 44230662 rs12076860 A G 274844
Genes possibly regulated by ZNF274[chr1:44230171-44230823]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:44230171-44230823]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results