Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr1 | 54875111 | rs538408014 | GCACACAGCGCAGGCTCAATACCTGTGTATGTTAA | G | 320428 | |
chr1 | 54875115 | rs188375179 | A | T | 320429 | |
chr1 | 54875119 | rs191292007 | C | T | 320430 | |
chr1 | 54875120 | rs368488271 | G | A | 320431 | |
chr1 | 54875179 | rs140320982 | C | CGA | 320432 | |
chr1 | 54875311 | rs213495 | A | C | 320433 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|---|---|---|---|---|---|---|---|---|---|---|
chr1 | 54691105 | 54879152 | - | SSBP3 | ENSG00000157216.11 | 54879152 | 0.79 | 1.0 | 3765 | 730 |
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|