Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 54866345 54877955 enh11868
chr1 54875187 54875373 vista1657

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 54875111 rs538408014 GCACACAGCGCAGGCTCAATACCTGTGTATGTTAA G 320428
chr1 54875115 rs188375179 A T 320429
chr1 54875119 rs191292007 C T 320430
chr1 54875120 rs368488271 G A 320431
chr1 54875179 rs140320982 C CGA 320432
chr1 54875311 rs213495 A C 320433

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 54691105 54879152 - SSBP3 ENSG00000157216.11 54879152 0.79 1.0 3824 730


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results