EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr1:168582806-168583495]
Chromosome characteristics of ZBTB33[chr1:168582806-168583495]
Back to top
Enhancers possibly regulated by ZBTB33[chr1:168582806-168583495]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 168576425 168585755 enh43075
Brain (SK-N-SH) Large Intestine Ovary Esophagus Stomach Uterus Kidney Muscle (Myotube) Neural Stem Cells (H9) Heart
chr1 168582981 168583414 vista3816
VISTA
SNP sites on ZBTB33[chr1:168582806-168583495]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 168582815 rs189908868 G A 710560
chr1 168583006 rs11271592 AGCTGCTGGGGCATCACTCTGGCT A 710561
chr1 168583020 rs182519648 C A 710562
chr1 168583032 rs548844461 TTCCAGCCTG T 710563
chr1 168583085 rs576328006 A G 710564
chr1 168583277 rs565165707 G T 710565
chr1 168583300 rs142416256 C A 710566
chr1 168583427 rs115241496 T C 710567
chr1 168583459 rs144441234 G A 710568
chr1 168583482 rs529752442 T C 710569
Genes possibly regulated by ZBTB33[chr1:168582806-168583495]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr1:168582806-168583495]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results