Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 172464365 172471715 enh12373
chr1 172466564 172466703 vista3890

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 172466375 rs139486328 C CCGGGTATCTATCCCCTACT 729041
chr1 172466375 rs368687183 C CCGGGTATCTATCCCCTACT 729042
chr1 172466379 rs570315206 G T 729043
chr1 172466457 rs537089554 C T 729044
chr1 172466468 rs558527486 G A 729045
chr1 172466509 rs12060122 G T 729046

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results