EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr1:172466292-172466981]
Chromosome characteristics of ZBTB33[chr1:172466292-172466981]
Back to top
Enhancers possibly regulated by ZBTB33[chr1:172466292-172466981]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 172464365 172471715 enh12373
Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-MC) Large Intestine Esophagus Muscle (A673) Placenta Lung (PC-9) Pancreas Neural Stem Cells (H9) Heart
chr1 172466564 172466703 vista3890
VISTA
SNP sites on ZBTB33[chr1:172466292-172466981]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 172466375 rs139486328 C CCGGGTATCTATCCCCTACT 729041
chr1 172466375 rs368687183 C CCGGGTATCTATCCCCTACT 729042
chr1 172466379 rs570315206 G T 729043
chr1 172466457 rs537089554 C T 729044
chr1 172466468 rs558527486 G A 729045
chr1 172466509 rs12060122 G T 729046
chr1 172466731 rs56410307 T C 729047
chr1 172466747 rs545862503 A G 729048
chr1 172466786 rs78516867 C T 729049
chr1 172466839 rs73032140 A T 729050
chr1 172466855 rs1984403 G T 729051
chr1 172466881 rs12118647 G A 729052
chr1 172466937 rs12145007 A T 729053
Genes possibly regulated by ZBTB33[chr1:172466292-172466981]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr1:172466292-172466981]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results