EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr1:172506877-172507333]
Chromosome characteristics of ZNF143[chr1:172506877-172507333]
Back to top
Enhancers possibly regulated by ZNF143[chr1:172506877-172507333]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 172503525 172518495 enh728
Prostate (PC-3) Blood (OCI-LY7) Blood (GM12878) Muscle (A673) Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Neural Stem Cells (H9) Stomach
chr1 172507125 172507604 vista3894
VISTA
SNP sites on ZNF143[chr1:172506877-172507333]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 172506922 rs192315702 G A 729294
chr1 172506934 rs184093000 G T 729295
chr1 172507054 rs113346597 A G 729296
chr1 172507119 rs548550904 A G 729297
chr1 172507131 rs190638666 C T 729298
chr1 172507306 rs529588168 T TGGAGGGTAAAGTGGAATGTAGGGGCCGTA 729299
chr1 172507331 rs534733007 A C 729300
Genes possibly regulated by ZNF143[chr1:172506877-172507333]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr1:172506877-172507333]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results