Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 211498150 211519175 enh904
chr1 211517513 211517976 vista4959

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 211516457 rs555630258 G A,C 915475
chr1 211516521 rs79920051 C T 915476
chr1 211516754 rs186968421 A G 915477
chr1 211516777 rs558278249 TATATC T 915478
chr1 211516888 rs191804280 G A 915479
chr1 211516933 rs558559438 G C 915480
chr1 211516976 rs11582143 G C,T 915481
chr1 211517018 rs142560341 C G 915482
chr1 211517038 rs74341547 C A,T 915483
chr1 211517202 rs2280079 G A 915484
chr1 211517254 rs6672233 A G 915485
chr1 211517258 rs544039126 GGGCTTCCTAGTGGAGAACAA G 915486
chr1 211517330 rs114635538 T G 915487
chr1 211517542 rs556218240 A T 915488

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results