Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 226810405 226819015 enh972
chr1 226815517 226815910 vista5360

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 226814705 rs149078296 G GACCGAATGTTTGTGCCCGCCCCCT 993238
chr1 226814705 rs376351162 G GACCGAATGTTTGTGCCCGCCCCCT 993239
chr1 226814761 rs10737424 G A 993240
chr1 226814778 rs697843 G C,T 993241
chr1 226814824 rs61489717 T A,C 993242
chr1 226814867 rs192843296 G A 993243
chr1 226814947 rs77033076 T C 993244
chr1 226814968 rs142188614 G C 993245
chr1 226815062 rs58303254 T C 993246
chr1 226815077 rs549687435 G A 993247
chr1 226815096 rs10799363 G A 993248
chr1 226815118 rs183097598 A C 993249
chr1 226815213 rs138811684 C T 993250
chr1 226815446 rs144732447 G T 993251
chr1 226815739 rs561534104 T A 993252

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results