| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr10 | 22904569 | rs565672263 | G | T | 1259621 | |
| chr10 | 22904668 | rs143282640 | A | G | 1259622 | |
| chr10 | 22904715 | rs117070332 | T | C | 1259623 | |
| chr10 | 22904722 | rs75937098 | T | C | 1259624 | |
| chr10 | 22904855 | rs555041904 | CGACTTCTTGTTCCTGTTTATGCCG | C | 1259625 | |
| chr10 | 22904903 | rs1326339 | G | A | 1259626 | |
| chr10 | 22904946 | rs141874086 | TGCTGCCCGGCCATTGGGCATCAAA | T | 1259627 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|