EnhancerDB
  1. Home
  2. TFBS
  3. MYC[chr10:22904835-22905435]
Chromosome characteristics of MYC[chr10:22904835-22905435]
Back to top
Enhancers possibly regulated by MYC[chr10:22904835-22905435]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 22898722 22924735 enh13049
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Adrenal Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Bone (Osteoblast) Blood (OCI-LY7) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr10 22904639 22904845 vista6778
VISTA
SNP sites on MYC[chr10:22904835-22905435]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 22904855 rs555041904 CGACTTCTTGTTCCTGTTTATGCCG C 1259625
chr10 22904903 rs1326339 G A 1259626
chr10 22904946 rs141874086 TGCTGCCCGGCCATTGGGCATCAAA T 1259627
chr10 22905131 rs1778351 G A 1259628
chr10 22905168 rs572331120 G A 1259629
chr10 22905189 rs1778352 G A 1259630
chr10 22905234 rs1778353 C T 1259631
chr10 22905321 rs1750752 A G 1259632
chr10 22905331 rs531325000 T G 1259633
Genes possibly regulated by MYC[chr10:22904835-22905435]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MYC[chr10:22904835-22905435]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results