Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 8833506 rs566246647 G A 1830660
chr11 8833649 rs537124744 T C 1830661
chr11 8833690 rs186377250 G A 1830662
chr11 8833800 rs3915868 A G 1830663
chr11 8833885 rs560899071 C G,T 1830664
chr11 8834010 rs11042081 G A 1830665
chr11 8834224 rs112982399 T C 1830666
chr11 8834373 rs147488089 A G 1830667
chr11 8834400 rs6484547 A G 1830668
chr11 8834472 rs11279390 TCCCAAAAA T 1830669
chr11 8834493 rs562665372 G GTTAT 1830670
chr11 8834545 rs138398892 GGTCTTGAACTCCTGAGCTCAA G 1830671
chr11 8834545 rs869095770 GGTCTTGAACTCCTGAGCTCAA G 1830672
chr11 8834610 rs191581522 T A 1830673
chr11 8834680 rs11603841 T C 1830674

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results