| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 10388190 | rs114088547 | C | T | 1840271 | |
| chr11 | 10388191 | rs148894678 | G | A | 1840272 | |
| chr11 | 10388311 | rs184458526 | C | T | 1840273 | |
| chr11 | 10388312 | rs151023382 | C | G,T | 1840274 | |
| chr11 | 10388412 | rs142339337 | G | A | 1840275 | |
| chr11 | 10388443 | rs546676119 | GGAACTCTGTTCAACAGATCCAGTT | G | 1840276 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|