Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 10384679 10390895 enh13755
chr11 10388178 10388602 vista9608

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 10388190 rs114088547 C T 1840271
chr11 10388191 rs148894678 G A 1840272
chr11 10388311 rs184458526 C T 1840273
chr11 10388312 rs151023382 C G,T 1840274
chr11 10388412 rs142339337 G A 1840275
chr11 10388443 rs546676119 GGAACTCTGTTCAACAGATCCAGTT G 1840276

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results