EnhancerDB

Chrom	Start	End	Enhancer ID	Tissues that enhancer appears	More
chr11	69240265	69271075	enh14035	Bone Marrow (K562) Astrocyte Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Bone (Osteoblast) Lung (A549) Thyroid Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr11	69257578	69257894	vista10762	VISTA
chr11	69258094	69258432	vista10763	VISTA

Chrom	Position	dbSNP ID	Reference Allele	Alternative Allele	id	More
chr11	69257836	rs570952322	G	A	2073854
chr11	69257844	rs7948512	C	G,T	2073855
chr11	69257850	rs145486721	C	A,T	2073856
chr11	69257927	rs11822814	A	G	2073857
chr11	69258006	rs116754027	T	C	2073858
chr11	69258074	rs7928827	A	G	2073859
chr11	69258102	rs143937141	AC	A	2073860
chr11	69258102	rs759773191	AC	A	2073861
chr11	69258164	rs574990467	C	A	2073862
chr11	69258204	rs375065016	G	C	2073863
chr11	69258378	rs572318287	GCCCCGCCAGCCCCATCACGGC	G	2073864
chr11	69258405	rs559332119	TGCCTTCTGCCGG	T	2073865
chr11	69258406	rs148301169	GCC	G	2073866
chr11	69258464	rs183209050	C	T	2073867

Blank TSI value indicates lack of sufficient expression for calculation
Chrom	Start	End	Strand	Gene Name	Ensembl ID	TSS	TSI of Normal tissues	TSI of Cancer tissues	Distance to TFBS	id	More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom	Start	End	strand	miRNA Name	miRBase ID	TSS	TSI of Normal tissues	TSI of Cancer tissues	Distance to TFBS	id	More

No results