Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 69258102 rs143937141 AC A 2073860
chr11 69258102 rs759773191 AC A 2073861
chr11 69258164 rs574990467 C A 2073862
chr11 69258204 rs375065016 G C 2073863
chr11 69258378 rs572318287 GCCCCGCCAGCCCCATCACGGC G 2073864
chr11 69258405 rs559332119 TGCCTTCTGCCGG T 2073865
chr11 69258406 rs148301169 GCC G 2073866

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results