EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:69258104-69258444]
Chromosome characteristics of ZNF274[chr11:69258104-69258444]
Back to top
Enhancers possibly regulated by ZNF274[chr11:69258104-69258444]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 69240265 69271075 enh14035
Bone Marrow (K562) Astrocyte Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Bone (Osteoblast) Lung (A549) Thyroid Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr11 69258094 69258432 vista10763
VISTA
SNP sites on ZNF274[chr11:69258104-69258444]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 69258164 rs574990467 C A 2073862
chr11 69258204 rs375065016 G C 2073863
chr11 69258378 rs572318287 GCCCCGCCAGCCCCATCACGGC G 2073864
chr11 69258405 rs559332119 TGCCTTCTGCCGG T 2073865
chr11 69258406 rs148301169 GCC G 2073866
Genes possibly regulated by ZNF274[chr11:69258104-69258444]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr11:69258104-69258444]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results