Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 69825585 69848635 enh67821
chr11 69830862 69831279 vista10788

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 69830471 rs67123885 ATTTTGAGTCCGGACTGAAACGAGATC A 2079461
chr11 69830481 rs559686738 CGGACTGAAACGAG C 2079462
chr11 69830495 rs545204832 ATC A 2079463
chr11 69830542 rs190600703 G A 2079464
chr11 69830543 rs183625424 C T 2079465
chr11 69830570 rs61885140 C T 2079466
chr11 69830613 rs116204613 C T 2079467
chr11 69830668 rs533274993 C G 2079468
chr11 69830683 rs75130418 C A 2079469

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results