EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:72451844-72452509]
Chromosome characteristics of ZNF274[chr11:72451844-72452509]
Back to top
Enhancers possibly regulated by ZNF274[chr11:72451844-72452509]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 72444521 72462512 enh1866
Bone Marrow (K562) Liver Astrocyte Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Uterus Blood (T-cell) Stomach Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Thyroid Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr11 72451817 72452230 vista10854
VISTA
chr11 72452508 72452870 vista10855
VISTA
SNP sites on ZNF274[chr11:72451844-72452509]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 72451859 rs147407736 G A 2095663
chr11 72451941 rs7128364 A C 2095664
chr11 72452111 rs143684038 T TCTGGCCCCACCACATACCC 2095665
chr11 72452111 rs58882407 T TCTGGCCCCACCACATACCC 2095666
chr11 72452324 rs550312705 C T 2095667
chr11 72452481 rs565778851 G A 2095668
Genes possibly regulated by ZNF274[chr11:72451844-72452509]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr11:72451844-72452509]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results