EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:72487989-72488485]
Chromosome characteristics of ZNF274[chr11:72487989-72488485]
Back to top
Enhancers possibly regulated by ZNF274[chr11:72487989-72488485]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 72473625 72491135 enh14070
Bone Marrow (K562) Skin (Keratinocyte) Liver (HepG2) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-SH) Lung (PC-9) Esophagus Astrocyte Liver Bone (Osteoblast) Stomach Placenta Muscle (Myoblast) Pancreas Muscle (Myotube) Uterus Heart
chr11 72487947 72488068 vista10860
VISTA
SNP sites on ZNF274[chr11:72487989-72488485]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 72488147 rs148320644 C T 2096003
chr11 72488211 rs116516327 T C 2096004
chr11 72488231 rs527492808 C T 2096005
chr11 72488331 rs546536344 G T 2096006
chr11 72488376 rs538418447 G A 2096007
chr11 72488478 rs551296790 CTGGTTGAATGACTGACAGAAGCTCT C 2096008
Genes possibly regulated by ZNF274[chr11:72487989-72488485]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr11:72487989-72488485]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results