EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr12:58238498-58239028]
Chromosome characteristics of ZZZ3[chr12:58238498-58239028]
Back to top
Enhancers possibly regulated by ZZZ3[chr12:58238498-58239028]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 58223192 58238686 enh14761
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Kidney Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Large Intestine Blood (GM12878) Placenta Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr12 58238225 58238735 vista13676
VISTA
SNP sites on ZZZ3[chr12:58238498-58239028]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 58238847 rs576061058 G A 2664463
chr12 58238985 rs149286879 CGCCCCAGCCTCCGGGGCCAGGTG C 2664464
Genes possibly regulated by ZZZ3[chr12:58238498-58239028]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 58213710 58240522 - CTDSP2 ENSG00000175215.5 58240522 0.65 1.0 1494 12272
Expression level of Genes
Back to top
miRNAs possibly regulated by ZZZ3[chr12:58238498-58239028]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 58218403 58218424 - hsa-miR-26a-2-3p MIMAT0004681 58240493 0.537666 0.501351 1465 306
Expression level of miRNAs
Back to top