Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 58238847 rs576061058 G A 2664463
chr12 58238985 rs149286879 CGCCCCAGCCTCCGGGGCCAGGTG C 2664464

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 58213710 58240522 - CTDSP2 ENSG00000175215.5 58240522 0.65 1.0 1481 12272


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 58218403 58218424 - hsa-miR-26a-2-3p MIMAT0004681 58240493 0.537666 0.501351 1452 306