Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 67817305 67832355 enh2418
chr12 67828762 67829103 vista13881

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 67828779 rs201917128 CT C 2704112
chr12 67828858 rs59869695 C A 2704113
chr12 67828886 rs1161084 A G 2704114
chr12 67828942 rs17249125 A G 2704115
chr12 67828975 rs576546274 T TTGTGTATGGGAATGTGAGTTCAGATCAGC 2704116

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results