Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 92498985 92505878 enh57620
chr12 92505299 92505700 vista14388

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 92505068 rs10777376 A G 2801463
chr12 92505127 rs141160487 CATA C 2801464
chr12 92505149 rs559681310 C T 2801465
chr12 92505199 rs115735211 A G 2801466
chr12 92505257 rs189718992 T A 2801467
chr12 92505290 rs116772718 T C 2801468
chr12 92505346 rs114832812 G A 2801469
chr12 92505496 rs57404256 T A 2801470
chr12 92505502 rs141353465 G T 2801471
chr12 92505523 rs17837114 G A 2801472
chr12 92505533 rs191624223 A G 2801473
chr12 92505603 rs145489195 G GTAGAGGATGGCTTGAACCTAGGAAC 2801474
chr12 92505624 rs75893856 G A 2801475

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results