Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 92498985 92505878 enh57620
chr12 92505299 92505700 vista14388

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 92505346 rs114832812 G A 2801469
chr12 92505496 rs57404256 T A 2801470
chr12 92505502 rs141353465 G T 2801471
chr12 92505523 rs17837114 G A 2801472
chr12 92505533 rs191624223 A G 2801473
chr12 92505603 rs145489195 G GTAGAGGATGGCTTGAACCTAGGAAC 2801474
chr12 92505624 rs75893856 G A 2801475
chr12 92505672 rs10637174 C CA,CAA,CAAA 2801476
chr12 92505672 rs59913296 C CA,CAA 2801477
chr12 92505760 rs143853434 C T 2801478
chr12 92505814 rs12810261 T C 2801479
chr12 92505847 rs77234948 G A 2801480
chr12 92505848 rs7953529 T C 2801481
chr12 92505932 rs709240 T C 2801482
chr12 92505966 rs116142942 T C 2801483

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results